| Item Type: | Dataset |
|---|---|
| Title: | qPCR_results |
| Creators Name: | Bartolomaeus, T.U.P. |
| Abstract: | For all samples collected for each time point, qPCR was performed using an Applied Biosystems QuantStudio 3 system (Thermo Fisher Scientific, Darmstadt, Germany). Amplification and detection were performed in 96-well optical plates (Applied Biosystems) with SYBR-Green (Applied Biosystems). All amplifications were performed in duplicates in a final volume of 5 µL containing 13.8 µL of a 2xSYBR Green PCR Master Mix including ROX as a passive reference (Applied Biosystems), 500 nM of each primer L. Crispatus (Lcrisp_CbsA2F: GTACCAAGCCAAAGCAAGAC - Crisp_CbsA2R: GTTTGAAGCCTTTACGTAAGTC), L jensenii (L_jensenii-Fw: AGTTCTTCGGAATGGACATAG - L_jensenii-Rev: GCCGCCTTTTAAACTTCT), L. gasseri (L_gasseri-Fw: TCAAGAGCTGTTAAGGCTGT - L_gasseri-Rev: CTATCGCTTCAAGTGCTTT), L. iners (L_iners-Fw: GTCTGCCTTGAAGATCGG - L_iners-Rev: ACAGTTGATAGGCATCATC), and L. rhamnosus (L_rhamnosus-Fw: TGCTTGCATCTTGATTTAATTTTG - L_rhamnosus-Rev: GTCCATTGTGGAAGATTCCC) and 1.2 µL of template DNA (0.5 mg/mL). For amplification, the standard protocol of the Applied Biosystems QuantStudio 3 system was followed, i.e., an initial cycle at 95°C for 10min, followed by 40 cycles at 95°C for 15 s, and 1 min at 60°C. To check for PCR product specificity, melting curve (Tm) analysis was performed, increasing the temperature from 60°C to 95°C at a rate of 0.2°C per second with continuous fluorescence monitoring. Standard curves for quantification consisted of 10-fold serial dilutions in the range of 108–100 copies of the 16S rRNA gene of the E. coli (Invitrogen, C404010) amplified with primers 27F (50-GTTTGATCCTGGCTCAG-30) and 1492R (50-CGGCTACCTTGTTACGAC-30). The total amount of bacterial 16S in rectal swabs was quantified with universal primers, Univ 337F 50-ACTCCTACGGGAGGCAGCAGT-30 and Univ 518R 50-GTATTACCGCGGCTGCTGGCAC-30. |
| Keywords: | Qpcr Analysis Demonstrates |
| Source: | Figshare |
| Publisher: | Figshare |
| Date: | 13 February 2024 |
| Official Publication: | https://doi.org/10.6084/m9.figshare.25213604 |
| Related to: |
Repository Staff Only: item control page
Tools
Tools
